Cart 2 Product Products 234,90 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003413 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAR1 |
| Origin species: | Human |
| Product name: | GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC003413 |
| Gene id: | 54433 |
| Gene description: | GAR1 ribonucleoprotein homolog (yeast) |
| Synonyms: | GAR1 ribonucleoprotein; snoRNP protein GAR1; GAR1 ribonucleoprotein homolog; GAR1 homolog, ribonucleoprotein; NOLA1; H/ACA ribonucleoprotein complex subunit 1; nucleolar protein family A member 1; nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttttcgaggcggaggtcgtggaggctttaatcgaggtggtggaggtggcggcttcaaccgaggcggcagcagcaaccacttccgaggtggaggcggcggtggaggcggcggcaatttcagaggcggcggcaggggaggatttggacgagggggtggccgcggaggctttaacaaaggccaagaccaaggacctccagaacgtgtagtcttattaggagagttcctgcatccctgtgaagatgacatagtttgtaaatgtaccacagatgaaaataaggtgccttatttcaatgctcctgtttacttagaaaacaaagaacaaattggaaaagtggatgaaatatttggacaactcagagatttttatttttcagttaagttgtcagaaaacatgaaggcttcatcctttaaaaaactacagaagttttatatagacccatataagctgctgccactgcagaggtttttacctcgacctccaggtgagaaaggacctccaagaggtggtggcaggggaggccgaggaggaggaagaggaggaggtggcagaggtggtggcagaggtggtggttttagaggtggaagaggaggtggaggtgggggcttcagaggaggaagaggtggtggtttcagagggagaggacattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Na+/H+ exchanger domain containing 1 - GINS complex subunit 4 (Sld5 homolog) - secretory carrier membrane protein 4 - secretory carrier membrane protein 5 |