Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED3-transmembrane emp24 protein transport domain containing 3 Gene
PTXBC000027
New product
Data sheet of TMED3-transmembrane emp24 protein transport domain containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED3-transmembrane emp24 protein transport domain containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000027 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED3 |
| Origin species: | Human |
| Product name: | TMED3-transmembrane emp24 protein transport domain containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC000027 |
| Gene id: | 23423 |
| Gene description: | transmembrane emp24 protein transport domain containing 3 |
| Synonyms: | C15orf22; P24B; p24g4; p26; transmembrane emp24 domain-containing protein 3; integral type I protein; membrane protein p24B; p24 family protein gamma-4; p24gamma4; testis tissue sperm-binding protein Li 48e; transmembrane emp24 protein transport domain containing 3; transmembrane p24 trafficking protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcagcactgtcccgcgctccgcctccgtgctgcttctgctgctgctcctgcgccgggccgagcagccctgcggggccgagctcaccttcgagctgccggacaacgccaagcagtgcttccacgaggaggtggagcagggcgtgaagttctccctggattaccaggtcatcactggaggccactacgatgttgactgctatgtagaggacccccaggggaacaccatctacagagaaacgaagaagcagtacgacagcttcacgtaccgggctgaagtcaagggcgtttatcagttttgcttcagtaatgagttttccaccttctctcacaagaccgtctactttgactttcaagtgggcgatgagcctcccattctcccagacatggggaacagggtcacagctctcacccagatggagtccgcctgcgtgaccatccatgaggctctgaaaacggtgattgactcccagacgcattaccggctgcgggaggcccaggaccgggcccgagcggaagaccttaatagccgagtctcttactggtctgttggcgagacgattgccctgttcgtggtcagcttcagtcaggtgctactgttgaaaagcttcttcacagaaaaacgacccatcagcagggcagtccactcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane emp24 protein transport domain containing 7 - MKI67 (FHA domain) interacting nucleolar phosphoprotein - oligonucleotide/oligosaccharide-binding fold containing 1 - solute carrier family 46 (folate transporter), member 1 |