RAN-RAN, member RAS oncogene family Gene

View larger

RAN-RAN, member RAS oncogene family Gene

Reference: PTXBC014518

Condition: New product

Print

Data sheet of RAN-RAN, member RAS oncogene family Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RAN-RAN, member RAS oncogene family Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC014518
Product type:	DNA & cDNA
Ncbi symbol:	RAN
Origin species:	Human
Product name:	RAN-RAN, member RAS oncogene family Gene
Size:	2ug
Accessions:	BC014518
Gene id:	5901
Gene description:	RAN, member RAS oncogene family
Synonyms:	RAN, member RAS oncogene family; guanosine triphosphatase Ran; GTPase Ran; GTP-binding nuclear protein Ran; ARA24; Gsp1; TC4; OK/SW-cl.81; RanGTPase; androgen receptor-associated protein 24; member RAS oncogene family; ras-like protein TC4; ras-related nuclear protein
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggctgcgcagggagagccccaggtccagttcaaacttgtattggttggtgatggtggtactggaaaaacgaccttcgtgaaacgtcatttgactggtgaatttgagaagaagtatgtagccaccttgggtgttgaggttcatcccctagtgttccacaccaacagaggacctattaagttcaatgtatgggacacagccggccaggagaaattcggtggactgagagatggctattatatccaagcccagtgtgccatcataatgtttgatgtaacatcgagagttacttacaagaatgtgcctaactggcatagagatctggtacgagtgtgtgaaaacatccccattgtgttgtgtggcaacaaagtggatattaaggacaggaaagtgaaggcgaaatccattgtcttccaccgaaagaagaatcttcagtactacgacatttctgccaaaagtaactacaactttgaaaagcccttcctctggcttgctaggaagctcattggagaccctaacttggaatttgttgccatgcctgctctcgccccaccagaagttgtcatggacccagctttggcagcacagtatgagcacgacttagaggttgctcagacaactgctctcccggatgaggatgatgacctgtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- melanoma antigen family H, 1 - NIPA-like domain containing 3 - ubiquitin domain containing 1 - ribose 5-phosphate isomerase A

Reviews

Be the first to write your review !

Buy RAN-RAN, member RAS oncogene family Gene now