Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GORASP1-golgi reassembly stacking protein 1, 65kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GORASP1-golgi reassembly stacking protein 1, 65kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008928 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GORASP1 |
| Origin species: | Human |
| Product name: | GORASP1-golgi reassembly stacking protein 1, 65kDa Gene |
| Size: | 2ug |
| Accessions: | BC008928 |
| Gene id: | 64689 |
| Gene description: | golgi reassembly stacking protein 1, 65kDa |
| Synonyms: | GOLPH5; GRASP65; P65; Golgi reassembly-stacking protein 1; Golgi peripheral membrane protein p65; Golgi phosphoprotein 5; Golgi reassembly and stacking protein 1; golgi reassembly stacking protein 1, 65kDa; golgi reassembly-stacking protein of 65 kDa; golgi reassembly stacking protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctgggcgtcagcgctgagcagcccgcaggcggcgccgagggcttccacctccacggggtgcaggagaactccccagcccagcaggcgggcctggagccctactttgacttcatcatcaccattgggcactcgaggctgaacaaggagaatgacaccctgaaggcactactgaaagccaatgtggagaagcccgtgaagctggaggtgttcaatatgaagaccatgagggtgcgcgaggtggaggtggtgcccagcaacatgtggggcggccagggcctactgggtgccagtgtgcgcttctgcagcttccgcagggccagtgagcaggtgtggcatgtgctggatgtggaaccatcttcacctgctgcccttgccggcctgcgcccctacacagactatgtggttggttcggaccagattctccaggagtccgaggacttctttacgctcatcgagtctcatgaggggaagcccttgaagctgatggtgtataactccaagtcagactcctgccgggagtctgggatgtggcattggctatgggtatctacaccggatcccaactcagccccccagctaccacaagaagccacctggcaccccaccaccttctgctctaccacttggtgccccaccacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coagulation factor VIII, procoagulant component - DnaJ (Hsp40) homolog, subfamily B, member 9 - alkB, alkylation repair homolog 8 (E. coli) - phosphatidylinositol transfer protein, beta |