HMGB1-high-mobility group box 1 Gene View larger

HMGB1-high-mobility group box 1 Gene

PTXBC003378

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMGB1-high-mobility group box 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMGB1-high-mobility group box 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003378
Product type: DNA & cDNA
Ncbi symbol: HMGB1
Origin species: Human
Product name: HMGB1-high-mobility group box 1 Gene
Size: 2ug
Accessions: BC003378
Gene id: 3146
Gene description: high-mobility group box 1
Synonyms: HMG-1; HMG1; HMG3; SBP-1; high mobility group protein B1; Amphoterin; Sulfoglucuronyl carbohydrate binding protein; high-mobility group (nonhistone chromosomal) protein 1; high mobility group box 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaggcggacaaggcccgttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttcaaggatcccaatgcacccaagaggcctccttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcagatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtcaaggctgaaaaaagcaagaaaaagaaggaagaggaggaagatgaggaagatgaagaggatgaggaggaggaggaagatgaagaagatgaagatgaagaagaagatgatgatgatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NudC domain containing 3
- acyl-CoA thioesterase 11
- transmembrane protein 54
- HEAT repeat containing 2

Reviews

Buy HMGB1-high-mobility group box 1 Gene now

Add to cart