Cart 8 Product Products 1 093,37 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 €
No products
To be determined Shipping
1 093,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 093,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 093,37 €
View larger 
TIA1-TIA1 cytotoxic granule-associated RNA binding protein Gene
PTXBC015944
New product
Data sheet of TIA1-TIA1 cytotoxic granule-associated RNA binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIA1-TIA1 cytotoxic granule-associated RNA binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015944 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIA1 |
| Origin species: | Human |
| Product name: | TIA1-TIA1 cytotoxic granule-associated RNA binding protein Gene |
| Size: | 2ug |
| Accessions: | BC015944 |
| Gene id: | 7072 |
| Gene description: | TIA1 cytotoxic granule-associated RNA binding protein |
| Synonyms: | TIA1 cytotoxic granule associated RNA binding protein; WDM; nucleolysin TIA-1 isoform p40; T-cell-restricted intracellular antigen-1; p40-TIA-1 (containing p15-TIA-1) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgcagctgcagcattagctgctatgaatggacggaagataatgggtaaggaagtcaaagtgaattgggcaacaacccctagcagtcaaaagaaagatacaagcagtagtaccgttgtcagcacacagcgttcacaagatcatttccatgtctttgttggtgatctcagcccagaaattacaactgaagatataaaagctgcttttgcaccatttggaagaatatcagatgcccgagtggtaaaagacatggcaacaggaaagtctaagggatatggctttgtctcctttttcaacaaatgggatgctgaaaacgccattcaacagatgggtggccagtggcttggtggaagacaaatcagaactaactgggcaacccgaaagcctcccgctccaaagagtacatatgagtgtaggtgtattggagaagaaaaggaaatgtggaattttggagaaaaatacgctagattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ChaC, cation transport regulator homolog 1 (E. coli) - nucleotide binding protein 2 (MinD homolog, E. coli) - cleavage and polyadenylation specific factor 3-like - cleavage and polyadenylation specific factor 3-like |