Cart 11 Product Products 1 276,99 € (empty)
-
-
1 x PTGR2-pros...121,50 € -
-
1 x PDCL3-phos...113,40 € -
1 x OR10H1-olf...121,50 € -
1 x YIPF2-Yip1...121,50 € -
-
1 x MAPKSP1-MA...113,40 € -
1 x BID-BH3...113,40 € -
1 x CD244-CD24...121,50 € -
1 x PAPLN-papi...113,40 €
No products
To be determined Shipping
1 276,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 276,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 276,99 €
View larger 
Data sheet of RGS2-regulator of G-protein signaling 2, 24kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RGS2-regulator of G-protein signaling 2, 24kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RGS2 |
| Origin species: | Human |
| Product name: | RGS2-regulator of G-protein signaling 2, 24kDa Gene |
| Size: | 2ug |
| Accessions: | BC007049 |
| Gene id: | 5997 |
| Gene description: | regulator of G-protein signaling 2, 24kDa |
| Synonyms: | G0S8; regulator of G-protein signaling 2; G0 to G1 switch regulatory 8, 24kD; G0/G1 switch regulatory protein 8; cell growth-inhibiting gene 31 protein; cell growth-inhibiting protein 31; regulator of G-protein signaling 2, 24kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaaagtgctatgttcttggctgttcaacacgactgcagacccatggacaagagcgcaggcagtggccacaagagcgaggagaagcgagaaaagatgaaacggacccttttaaaagattggaagacccgtttgagctacttcttacaaaattcctctactcctgggaagcccaaaaccggcaaaaaaagcaaacagcaagctttcatcaagccttctcctgaggaagcacagctgtggtcagaagcatttgacgagctgctagccagcaaatatggtcttgctgcattcagggcttttttaaagtcggaattctgtgaagaaaatattgaattctggctggcctgtgaagacttcaaaaaaaccaaatcaccccaaaagctgtcctcaaaagcaaggaaaatatatactgacttcatagaaaaggaagctccaaaagagataaacatagattttcaaaccaaaactctgattgcccagaatatacaagaagctacaagtggctgctttacaactgcccagaaaagggtatacagcttgatggagaacaactcttatcctcgtttcttggagtcagaattctaccaggacttgtgtaaaaagccacaaatcaccacagagcctcatgctacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 4, member D - trafficking protein particle complex 4 - cell death-inducing DFFA-like effector c - 2,4-dienoyl CoA reductase 2, peroxisomal |