Cart 1 Product Products 113,40 € (empty)
-
1 x APOBEC3C-a...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of TIMP3-TIMP metallopeptidase inhibitor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMP3-TIMP metallopeptidase inhibitor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014277 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMP3 |
| Origin species: | Human |
| Product name: | TIMP3-TIMP metallopeptidase inhibitor 3 Gene |
| Size: | 2ug |
| Accessions: | BC014277 |
| Gene id: | 7078 |
| Gene description: | TIMP metallopeptidase inhibitor 3 |
| Synonyms: | HSMRK222; K222; K222TA2; SFD; metalloproteinase inhibitor 3; MIG-5 protein; protein MIG-5; tissue inhibitor of metalloproteinases 3; TIMP metallopeptidase inhibitor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccccttggctcgggctcatcgtgctcctgggcagctggagcctgggggactggggcgccgaggcgtgcacatgctcgcccagccacccccaggacgccttctgcaactccgacatcgtgatccgggccaaggtggtggggaagaagctggtaaaggaggggcccttcggcacgctggtctacaccatcaagcagatgaagatgtaccgaggcttcaccaagatgccccatgtgcagtacatccatacggaagcttccgagagtctctgtggccttaagctggaggtcaacaagtaccagtacctgctgacaggtcgcgtctatgatggcaagatgtacacggggctgtgcaacttcgtggagaggtgggaccagctcaccctctcccagcgcaaggggctgaactatcggtatcacctgggttgtaactgcaagatcaagtcctgctactacctgccttgctttgtgacttccaagaacgagtgtctctggaccgacatgctctccaatttcggttaccctggctaccagtccaaacactacgcctgcatccggcagaagggcggctactgcagctggtaccgaggatgggcccccccggataaaagcatcatcaatgccacagacccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB5A, member RAS oncogene family - RAB3D, member RAS oncogene family - TIMP metallopeptidase inhibitor 4 - coiled-coil domain containing 34 |