Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RILPL2-Rab interacting lysosomal protein-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RILPL2-Rab interacting lysosomal protein-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013042 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RILPL2 |
| Origin species: | Human |
| Product name: | RILPL2-Rab interacting lysosomal protein-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC013042 |
| Gene id: | 196383 |
| Gene description: | Rab interacting lysosomal protein-like 2 |
| Synonyms: | RLP2; RILP-like protein 2; p40phox-binding protein; rab-interacting lysosomal protein-like 2; Rab interacting lysosomal protein like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagccccctgtgcgagaagaggaagaggaggagggagaggaggacgaggagagggacgaggttgggcccgagggggcgctgggcaagagccccttccagctgaccgccgaggacgtgtatgacatctcctacctgttgggccgcgagcttatggccctgggcagcgacccccgggtgacgcagctgcagttcaaagtcgtccgcgtcctggagatgctggaggcgctggtgaatgagggcagcctggcgctggaggagctgaagatggagagggaccacctcaggaaggaggtggaggggctgcggagacagagccctccggccagcggggaggtgaacctgggcccaaacaaaatggtggttgacctgacagatcccaaccgaccccgcttcactctgcaggagctaagggatgtgctgcaggaacgcaacaaactcaagtcgcagctcctggtggtgcaggaagagctgcagtgctacaagagtggcctgattccaccaagagaaggcccaggaggaagaagagaaaaagatgctgtggttactagtgccaaaaatgctggcaggaacaaggaggagaagacaatcataaaaaagctgttcttttttcgatcggggaaacagacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase A2, group IVD (cytosolic) - nitric oxide synthase interacting protein - non-POU domain containing, octamer-binding - cAMP responsive element binding protein 3 |