PTXBC012798
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC012798 |
Product type: | DNA & cDNA |
Ncbi symbol: | NOL3 |
Origin species: | Human |
Product name: | NOL3-nucleolar protein 3 (apoptosis repressor with CARD domain) Gene |
Size: | 2ug |
Accessions: | BC012798 |
Gene id: | 8996 |
Gene description: | nucleolar protein 3 (apoptosis repressor with CARD domain) |
Synonyms: | ARC; FCM; MYP; NOP; NOP30; nucleolar protein 3; muscle-enriched cytoplasmic protein; nucleolar protein 3 (apoptosis repressor with CARD domain); nucleolar protein of 30 kDa |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggcaacgcgcaggagcggccgtcagagactatcgaccgcgagcggaaacgcctggtcgagacgctgcaggcggactcgggactgctgttggacgcgctgctggcgcggggcgtgctcaccgggccagagtacgaggcattggatgcactgcctgatgccgagcgcagggtgcgccgcctactgctgctggtgcagggcaagggcgaggccgcctgccaggagctgctacgctgtgcccagcgtaccgcgggcgcgccggaccccgcttgggactggcagcacgtgggtccgggctaccgggaccgcagctatgaccctccatgcccaggccactggacgccggaggcacccggctcggggaccacatgccccgggttgcccagagcttcagaccctgacgaggccgggggccctgagggctccgaggcggtgcaatccgggaccccggaggagccagagccagagctggaagctgaggcctctaaagaggctgaaccggagccggagccagagccagagctggaacccgaggctgaagcagaaccagagccggaactggagccagaaccggacccagagcccgagcccgacttcgaggaaagggacgagtccgaagattcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - transmembrane emp24 protein transport domain containing 3 - transmembrane emp24 protein transport domain containing 7 - MKI67 (FHA domain) interacting nucleolar phosphoprotein - oligonucleotide/oligosaccharide-binding fold containing 1 |