Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NOL3-nucleolar protein 3 (apoptosis repressor with CARD domain) Gene
PTXBC012798
New product
Data sheet of NOL3-nucleolar protein 3 (apoptosis repressor with CARD domain) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NOL3-nucleolar protein 3 (apoptosis repressor with CARD domain) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012798 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NOL3 |
| Origin species: | Human |
| Product name: | NOL3-nucleolar protein 3 (apoptosis repressor with CARD domain) Gene |
| Size: | 2ug |
| Accessions: | BC012798 |
| Gene id: | 8996 |
| Gene description: | nucleolar protein 3 (apoptosis repressor with CARD domain) |
| Synonyms: | ARC; FCM; MYP; NOP; NOP30; nucleolar protein 3; muscle-enriched cytoplasmic protein; nucleolar protein 3 (apoptosis repressor with CARD domain); nucleolar protein of 30 kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaacgcgcaggagcggccgtcagagactatcgaccgcgagcggaaacgcctggtcgagacgctgcaggcggactcgggactgctgttggacgcgctgctggcgcggggcgtgctcaccgggccagagtacgaggcattggatgcactgcctgatgccgagcgcagggtgcgccgcctactgctgctggtgcagggcaagggcgaggccgcctgccaggagctgctacgctgtgcccagcgtaccgcgggcgcgccggaccccgcttgggactggcagcacgtgggtccgggctaccgggaccgcagctatgaccctccatgcccaggccactggacgccggaggcacccggctcggggaccacatgccccgggttgcccagagcttcagaccctgacgaggccgggggccctgagggctccgaggcggtgcaatccgggaccccggaggagccagagccagagctggaagctgaggcctctaaagaggctgaaccggagccggagccagagccagagctggaacccgaggctgaagcagaaccagagccggaactggagccagaaccggacccagagcccgagcccgacttcgaggaaagggacgagtccgaagattcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane emp24 protein transport domain containing 3 - transmembrane emp24 protein transport domain containing 7 - MKI67 (FHA domain) interacting nucleolar phosphoprotein - oligonucleotide/oligosaccharide-binding fold containing 1 |