Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RPS4X-ribosomal protein S4, X-linked Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPS4X-ribosomal protein S4, X-linked Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007308 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPS4X |
| Origin species: | Human |
| Product name: | RPS4X-ribosomal protein S4, X-linked Gene |
| Size: | 2ug |
| Accessions: | BC007308 |
| Gene id: | 6191 |
| Gene description: | ribosomal protein S4, X-linked |
| Synonyms: | CCG2; DXS306; RPS4; SCAR; SCR10; 40S ribosomal protein S4, X isoform; cell cycle gene 2; ribosomal protein S4X isoform; single copy abundant mRNA protein; single-copy abundant mRNA; ribosomal protein S4, X-linked |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagcggttcattaaaatcgatggcaaggtccgaactgatataacctaccctgctggattcatggatgtcatcagcattgacaagacgggagagaatttccgtctgatctatgacaccaagggtcgctttgctgtacatcgtattacacctgaggaggccaagtacaagttgtgcaaagtgagaaagatctttgtgggcacaaaaggaatccctcatctggtgactcatgatgcccgcaccatccgctaccccgatcccctcatcaaggtgaatgataccattcagattgatttagagactggcaagattactgatttcatcaagttcgacactggtaacctgtgtatggtgactggaggtgctaacctaggaagaattggtgtgatcaccaacagagagaggcaccctggatcttttgacgtggttcacgtgaaagatgccaatggcaacagctttgccactcgactttccaacatttttgttattggcaagggcaacaaaccatggatttctcttccccgaggaaagggtatccgcctcaccattgctgaagagagagacaaaagactggcggccaaacagagcagtgggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutathione S-transferase mu 4 - ATP/GTP binding protein-like 2 - deafness, autosomal dominant 5 - neurogenic differentiation 1 |