Cart 1 Product Products 121,50 € (empty)
-
1 x IMPACT-Imp...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of RNF185-ring finger protein 185 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF185-ring finger protein 185 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009504 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF185 |
| Origin species: | Human |
| Product name: | RNF185-ring finger protein 185 Gene |
| Size: | 2ug |
| Accessions: | BC009504 |
| Gene id: | 91445 |
| Gene description: | ring finger protein 185 |
| Synonyms: | E3 ubiquitin-protein ligase RNF185; BSK65-MONO1; BSK65-MONO2; BSK65-PANC1; BSK65-PANC2; BSK65-TEST1; BSK65-TEST2; BSK65-TEST3; ring finger protein 185 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaagcaaggggccctcggcctctgcatctcctgagaactccagtgcaggggggcccagtgggagcagcaatggcgctggcgagagcggagggcaggacagcactttcgagtgcaacatctgcttggacacagccaaggatgccgtcatcagcctgtgtggccacctcttctgttggccgtgtttacatcagtggttggagaccagacctaacagacaggtgtgtcctgtttgcaaagctggcatcagccgagacaaggtcatccccctctatggaaggggcagcactgggcaacaggaccccagagagaagacccctcctcgtcctcaaggacagaggccagagccggagaatagagggggatttcaaggatttggatttggagatggtggcttccagatgtcttttggaattggggcatttccctttgggatatttgccacagcatttaatataaatgatgggcggcctcctccagctgtccctgggacaccccagtatgtggacgagcagttcctgtcacgcctcttcctatttgtggccctggtgatcatgttctggctcctgattgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GM2 ganglioside activator - density-regulated protein - zinc finger protein 323 - PARK2 co-regulated-like |