Cart 6 Product Products 683,21 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 €
No products
To be determined Shipping
683,21 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 683,21 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 683,21 €
Data sheet of GPX7-glutathione peroxidase 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPX7-glutathione peroxidase 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032788 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPX7 |
| Origin species: | Human |
| Product name: | GPX7-glutathione peroxidase 7 Gene |
| Size: | 2ug |
| Accessions: | BC032788 |
| Gene id: | 2882 |
| Gene description: | glutathione peroxidase 7 |
| Synonyms: | CL683; GPX6; GPx-7; GSHPx-7; NPGPx; glutathione peroxidase 7; glutathione peroxidase 6; non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggcggcgacggtggcagcggcgtggctgctcctgtgggctgcggcctgcgcgcagcaggagcaggacttctacgacttcaaggcggtcaacatccggggcaaactggtgtcgctggagaagtaccgcggatcggtgtccctggtggtgaatgtggccagcgagtgcggcttcacagaccagcactaccgagccctgcagcagctgcagcgagacctgggcccccaccacttcaacgtgctcgccttcccctgcaaccagtttggccaacaggagcctgacagcaacaaggagattgagagctttgcccgccgcacctacagtgtctcattccccatgtttagcaagattgcagtcaccggtactggtgcccatcctgccttcaagtacctggcccagacttctgggaaggagcccacctggaacttctggaagtacctagtagccccagatggaaaggtggtaggggcttgggacccaactgtgtcagtggaggaggtcagaccccagatcacagcgctcgtgaggaagctcatcctactgaagcgagaagacttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TM2 domain containing 1 - SET domain containing 3 - TM2 domain containing 3 - FK506 binding protein 7 |