Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UQCC-ubiquinol-cytochrome c reductase complex chaperone Gene
PTXBC008871
New product
Data sheet of UQCC-ubiquinol-cytochrome c reductase complex chaperone Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCC-ubiquinol-cytochrome c reductase complex chaperone Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008871 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCC |
| Origin species: | Human |
| Product name: | UQCC-ubiquinol-cytochrome c reductase complex chaperone Gene |
| Size: | 2ug |
| Accessions: | BC008871 |
| Gene id: | 55245 |
| Gene description: | ubiquinol-cytochrome c reductase complex chaperone |
| Synonyms: | UQCC; BFZB; C20orf44; CBP3; ubiquinol-cytochrome-c reductase complex assembly factor 1; bFGF-repressed Zic-binding protein; basic FGF-repressed Zic-binding protein; cytochrome B protein synthesis 3 homolog; ubiquinol-cytochrome c reductase complex chaperone CBP3 homolog; ubiquinol-cytochrome c reductase complex assembly factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagccgattgatacctgtgtctcctacccaaggacagggggacagggctctgtctcgcacttcccagggtgtcagatgcctgatacattcaattcatggtttcttataaccctactccacgtctggatgtgtctagtccgaatgaagcaggaaggccggagtgggaagtacatgtgtcgtatcatagttcattttatgtgggaggatgttcagcagcgcggcagagtcatgggggttaatccctatatcctgaagaagaacatgatcctcatgacaaatcatttctatgcagcgatcttgggatatgatgaggggatcctttcagatgatcatgggctggccgctgccctctggagaaccttcttcaaccggaaatgtgaagaccctcgacatcttgaattgctggtagagtatgtgaggaaacagatacagtacctggactccatgaacggggaggatctgcttctgacaggggaggtgagctggcgccctctagtggagaagaatcctcagagcatcctgaagccccattctccgacttacaacgacgagggactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 108, member A1 - non-SMC element 2, MMS21 homolog (S. cerevisiae) - UDP glycosyltransferase 3 family, polypeptide A1 - non imprinted in Prader-Willi/Angelman syndrome 1 |