Cart 6 Product Products 851,50 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 €
No products
To be determined Shipping
851,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 851,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 851,50 €
Data sheet of MFAP5-microfibrillar associated protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MFAP5-microfibrillar associated protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005901 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MFAP5 |
| Origin species: | Human |
| Product name: | MFAP5-microfibrillar associated protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC005901 |
| Gene id: | 8076 |
| Gene description: | microfibrillar associated protein 5 |
| Synonyms: | THE1A-MFAP5; AAT9; MAGP-2; MAGP2; MFAP-5; MP25; microfibrillar-associated protein 5; microfibril-associated glycoprotein-2; microfibrillar associated protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctcttgggacccaaggtgctgctgtttcttgctgcattcatcatcacctctgactggatacccctgggggtcaatagtcaacgaggagacgatgtgactcaagcgactccagaaacattcacagaagatcctaatctggtgaatgatcccgctacagatgaaacagttttggctgttttggctgatattgcaccttccacagatgacttggcctccctcagtgaaaaaaataccactgcagagtgctgggatgagaaatttacctgcacaaggctctactctgtgcatcggccggttaaacaatgcattcatcagttatgcttcaccagtttacgacgtatgtacatcgtcaacaaggagatctgctctcgtcttgtctgtaaggaacacgaagctatgaaagatgagctttgccgtcagatggctggtctgccccctaggagactccgtcgctccaattacttccgacttcctccctgtgaaaatgtggatttgcagagacccaatggtctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - organic solute transporter alpha - abhydrolase domain containing 14B - RAB39B, member RAS oncogene family - RAB11A, member RAS oncogene family |