Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of BTG1-B-cell translocation gene 1, anti-proliferative Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BTG1-B-cell translocation gene 1, anti-proliferative Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016759 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BTG1 |
| Origin species: | Human |
| Product name: | BTG1-B-cell translocation gene 1, anti-proliferative Gene |
| Size: | 2ug |
| Accessions: | BC016759 |
| Gene id: | 694 |
| Gene description: | B-cell translocation gene 1, anti-proliferative |
| Synonyms: | protein BTG1; APRO2; B-cell translocation gene 1 protein; B-cell translocation gene 1, anti-proliferative; BTG anti-proliferation factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatcccttctacacccgggccgccaccatgataggcgagatcgccgccgccgtgtccttcatctccaagtttctccgcaccaaggggctcacgagcgagcgacagctgcagaccttcagccagagcctgcaggagctgctggcagaacattataaacatcactggttcccagaaaagccatgcaagggatcgggttaccgttgtattcgcatcaaccataaaatggatcctctgattggacaggcagcacagcggattggactgagcagtcaggagctgttcaggcttctcccaagtgaactcacactctgggttgacccctatgaagtgtcctacagaattggagaggatggctccatctgtgtgctgtatgaagcctcaccagcaggaggtagcactcaaaacagcaccaacgtgcaaatggtagacagccgaatcagctgtaaggaggaacttctcttgggcagaacgagcccttccaaaaactacaatatgatgactgtatcaggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nicotinamide nucleotide adenylyltransferase 3 - cell division cycle 34 homolog (S. cerevisiae) - complement component 1, q subcomponent, C chain - granzyme H (cathepsin G-like 2, protein h-CCPX) |