RFK-riboflavin kinase Gene View larger

RFK-riboflavin kinase Gene

PTXBC007069

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RFK-riboflavin kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RFK-riboflavin kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007069
Product type: DNA & cDNA
Ncbi symbol: RFK
Origin species: Human
Product name: RFK-riboflavin kinase Gene
Size: 2ug
Accessions: BC007069
Gene id: 55312
Gene description: riboflavin kinase
Synonyms: RIFK; riboflavin kinase; 0610038L10Rik; ATP:riboflavin 5'-phosphotransferase; flavokinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccgagcggactgcattatgaggcacctgccttacttctgccggggtcaagtggtgcggggcttcggccgcggctccaagcagctgggcatccccacagctaattttcctgagcaagtggtagataatcttccagctgatatatccactggtatttactatggttgggccagtgttggaagtggagatgtccataagatggtggtgagcataggatggaacccatattacaagaatacgaagaagtctatggaaacacatatcatgcataccttcaaagaggacttctatggggaaatcctcaatgtcgccattgttggctacctgagaccagaaaagaactttgattctttagagtcacttatttcagcaattcaaggtgatattgaagaagctaagaaacgactagagttaccagaacatttgaaaatcaaagaagacaatttcttccaggtttctaaaagcaaaataatgaatggccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxiredoxin 1
- forkhead box A3
- spermine synthase
- mevalonate kinase

Reviews

Buy RFK-riboflavin kinase Gene now

Add to cart