PTXBC008865
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008865 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM96A |
Origin species: | Human |
Product name: | FAM96A-family with sequence similarity 96, member A Gene |
Size: | 2ug |
Accessions: | BC008865 |
Gene id: | 84191 |
Gene description: | family with sequence similarity 96, member A |
Synonyms: | MIP18 family protein FAM96A; CIA2A; family with sequence similarity 96 member A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcagcgggtgtccgggctgctctcctggacgctgagcagagtcctgtggctctccggcctctctgagccgggagctgcccggcagccccggatcatggaagagaaagcgctagaggtttatgatttgattagaactatccgggacccagaaaagcccaatactttagaagaactggaagtggtctcggaaagttgtgtggaagttcaggagataaatgaagaagaatatctggttattatcaggttcacgccaacagtacctcattgctctttggcgactcttattgggctgtgcttaagagtaaaacttcagcgatgtttaccatttaaacataagttggaaatctacatttctgaaggaacccactcaacagaagaagacatcaataagcagataaatgacaaagagcgagtggcagctgcaatggaaaaccccaacttacgggaaattgtggaacagtgtgtccttgaacctgactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - tRNA selenocysteine 1 associated protein 1 - RAS-like, estrogen-regulated, growth inhibitor - family with sequence similarity 73, member B - tubulointerstitial nephritis antigen-like 1 |