Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene
PTXBC005263
New product
Data sheet of SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005263 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SDHD |
| Origin species: | Human |
| Product name: | SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene |
| Size: | 2ug |
| Accessions: | BC005263 |
| Gene id: | 6392 |
| Gene description: | succinate dehydrogenase complex, subunit D, integral membrane protein |
| Synonyms: | CBT1; CII-4; CWS3; PGL; PGL1; QPs3; SDH4; cybS; succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial; succinate dehydrogenase complex subunit D integral membrane protein; succinate-ubiquinone oxidoreductase cytochrome b small subunit; succinate-ubiquinone reductase membrane anchor subunit; succinate dehydrogenase complex subunit D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggttctctggaggctgagtgccgtttgcggtgccctaggaggccgagctctgttgcttcgaactccagtggtcagacctgctcatatctcagcatttcttcaggaccgacctatcccagaatggtgtggagtgcagcacatacacttgtcaccgagccaccattctggctccaaggctgcatctctccactggactagcgagagggttgtcagtgttttgctcctgggtctgcttccggctgcttatttgaatccttgctctgcgatggactattccctggctgcagccctcactcttcatggtcactggggccttggacaagttgttactgactatgttcatggggatgccttgcagaaagctgccaaggcagggcttttggcactttcagctttaacctttgctgggctttgctatttcaactatcacgatgtgggcatctgcaaagctgttgccatgctgtggaagctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal sequence receptor, gamma (translocon-associated protein gamma) - sorting and assembly machinery component 50 homolog (S. cerevisiae) - sorting and assembly machinery component 50 homolog (S. cerevisiae) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 |