Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL1RN-interleukin 1 receptor antagonist Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1RN-interleukin 1 receptor antagonist Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009745 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1RN |
| Origin species: | Human |
| Product name: | IL1RN-interleukin 1 receptor antagonist Gene |
| Size: | 2ug |
| Accessions: | BC009745 |
| Gene id: | 3557 |
| Gene description: | interleukin 1 receptor antagonist |
| Synonyms: | DIRA; ICIL-1RA; IL-1RN; IL-1ra; IL-1ra3; IL1F3; IL1RA; IRAP; MVCD4; interleukin-1 receptor antagonist protein; IL1 inhibitor; intracellular IL-1 receptor antagonist type II; intracellular interleukin-1 receptor antagonist (icIL-1ra); type II interleukin-1 receptor antagonist; interleukin 1 receptor antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttagagacgatctgccgaccctctgggagaaaatccagcaagatgcaagccttcagaatctgggatgttaaccagaagaccttctatctgaggaacaaccaactagttgccggatacttgcaaggaccaaatgtcaatttagaagaaaagatagatgtggtacccattgagcctcatgctctgttcttgggaatccatggagggaagatgtgcctgtcctgtgtcaagtctggtgatgagaccagactccagctggaggcagttaacatcactgacctgagcgagaacagaaagcaggacaagcgcttcgccttcatccgctcagacagtggccccaccaccagttttgagtctgccgcctgccccggttggttcctctgcacagcgatggaagctgaccagcccgtcagcctcaccaatatgcctgacgaaggcgtcatggtcaccaaattctacttccaggaggacgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TIMP metallopeptidase inhibitor 3 - RAB5A, member RAS oncogene family - RAB3D, member RAS oncogene family - TIMP metallopeptidase inhibitor 4 |