Cart 23 Product Products 3 271,96 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 € -
1 x MRPL44-mit...121,50 € -
1 x PSMB7-prot...121,50 € -
1 x LINCR-like...113,40 € -
-
-
1 x PTPN7-prot...121,50 € -
1 x NAPRT1-nic...121,50 € -
1 x C2orf56-ch...113,40 € -
1 x PPIL1-pept...113,40 € -
1 x DUSP13-dua...113,40 € -
1 x C17orf89-c...113,40 € -
1 x LRRN4CL-LR...113,40 €
No products
To be determined Shipping
3 271,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 271,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 271,96 €
Data sheet of TMEM50A-transmembrane protein 50A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM50A-transmembrane protein 50A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007341 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM50A |
| Origin species: | Human |
| Product name: | TMEM50A-transmembrane protein 50A Gene |
| Size: | 2ug |
| Accessions: | BC007341 |
| Gene id: | 23585 |
| Gene description: | transmembrane protein 50A |
| Synonyms: | IFNRC; SMP1; transmembrane protein 50A; cervical cancer oncogene 9; small membrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggatttctagagggcttgagatgctcagaatgcattgactggggggaaaagcgcaatactattgcttccattgctgctggtgtactattttttacaggctggtggattatcatagatgcagctgttatttatcccaccatgaaagatttcaaccactcataccatgcctgtggtgttatagcaaccatagccttcctaatgattaatgcagtatcgaatggacaagtccgaggtgatagttacagtgaaggttgtctgggtcaaacaggtgctcgcatttggcttttcgttggtttcatgttggcctttggatctctgattgcatctatgtggattctttttggaggttatgttgctaaagaaaaagacatagtataccctggaattgctgtatttttccagaatgccttcatcttttttggagggctggtttttaagtttggccgcactgaagacttatggcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 208 - transmembrane protein 87A - COMM domain containing 10 - transmembrane protein 125 |