DUSP3-dual specificity phosphatase 3 Gene View larger

DUSP3-dual specificity phosphatase 3 Gene

PTXBC035701

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP3-dual specificity phosphatase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP3-dual specificity phosphatase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035701
Product type: DNA & cDNA
Ncbi symbol: DUSP3
Origin species: Human
Product name: DUSP3-dual specificity phosphatase 3 Gene
Size: 2ug
Accessions: BC035701
Gene id: 1845
Gene description: dual specificity phosphatase 3
Synonyms: dual specificity protein phosphatase 3; dual specificity protein phosphatase VHR; serine/threonine specific protein phosphatase; vaccinia H1-related phosphatase; vaccinia virus phosphatase VH1-related; dual specificity phosphatase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtggctcaggacatccccaagctgcagaaactaggcatcacccatgtgctgaacgcggctgagggcaggtccttcatgcacgtcaacaccaatgccaacttctacaaggactccggcatcacatacctgggcatcaaggccaacgacacacaggagttcaacctcagcgcttactttgaaagggctgccgacttcattgaccaggctttggctcaaaagaatggccgggtgctcgtccactgccgggaaggttatagccgctccccaacgctagttatcgcctacctcatgatgcggcagaagatggacgtcaagtctgccctgagcatcgtgaggcagaaccgtgagatcggccccaacgatggcttcctggcccagctctgccagctcaatgacagactagccaaggaggggaagttgaaaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FK506 binding protein 6, 36kDa
- dihydropyrimidine dehydrogenase
- ribosomal protein S4, X-linked
- glutathione S-transferase mu 4

Reviews

Buy DUSP3-dual specificity phosphatase 3 Gene now

Add to cart