NDP-Norrie disease (pseudoglioma) Gene

View larger

NDP-Norrie disease (pseudoglioma) Gene

Reference: PTXBC029901

Condition: New product

Print

Data sheet of NDP-Norrie disease (pseudoglioma) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about NDP-Norrie disease (pseudoglioma) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC029901
Product type:	DNA & cDNA
Ncbi symbol:	NDP
Origin species:	Human
Product name:	NDP-Norrie disease (pseudoglioma) Gene
Size:	2ug
Accessions:	BC029901
Gene id:	4693
Gene description:	Norrie disease (pseudoglioma)
Synonyms:	NDP, norrin cystine knot growth factor; EVR2; FEVR; norrin; Norrie disease (pseudoglioma); X-linked exudative vitreoretinopathy 2 protein; norrie disease protein
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgagaaaacatgtactagctgcatccttttctatgctctccctgctggtgataatgggagatacagacagtaaaacggacagctcattcataatggactcggaccctcgacgctgcatgaggcaccactatgtggattctatcagtcacccattgtacaagtgtagctcaaagatggtgctcctggccaggtgcgaggggcactgcagccaggcgtcacgctccgagcctttggtgtcgttcagcactgtcctcaagcaacccttccgttcctcctgtcactgctgccggccccagacttccaagctgaaggcactgcggctgcgatgctcagggggcatgcgactcactgccacctaccggtacatcctctcctgtcactgcgaggaatgcaattcctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- glia maturation factor, beta - transmembrane protein 50A - transmembrane protein 208 - transmembrane protein 87A

Reviews

Be the first to write your review !

Buy NDP-Norrie disease (pseudoglioma) Gene now