Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2AM-histone cluster 1, H2am Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2AM-histone cluster 1, H2am Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032756 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2AM |
| Origin species: | Human |
| Product name: | HIST1H2AM-histone cluster 1, H2am Gene |
| Size: | 2ug |
| Accessions: | BC032756 |
| Gene id: | 8336 |
| Gene description: | histone cluster 1, H2am |
| Synonyms: | H2A.1; H2A/n; H2AFN; dJ193B12.1; histone H2A type 1; H2A histone family, member N; histone 1, H2am; histone cluster 1, H2am; histone cluster 1 H2A family member m |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggacgtggcaagcagggcggcaaggctcgcgccaaggccaaaacccgctcctctagagctgggctccaatttcctgtaggacgagtgcaccgcctgctccgcaagggcaactacgctgagcgggtcggggccggcgcgccggtttacctggcggcggtgctggagtacctaactgccgagatcctggagctggcgggcaacgcagcccgcgacaacaaaaagacccgcatcatcccgcgccacttgcagctggccatccgcaacgacgaggagctcaacaagctgcttggtaaagttaccatcgctcagggcggtgttctgcctaacatccaggccgtactgctccccaagaagactgagagccaccacaaagctaagggcaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Norrie disease (pseudoglioma) - glia maturation factor, beta - transmembrane protein 50A - transmembrane protein 208 |