Cart 18 Product Products 2 343,98 € (empty)
-
1 x C13orf3-ch...121,50 € -
1 x HIST4H4-hi...113,40 € -
1 x POU5F2-POU...121,50 € -
-
1 x COX7C-cyto...113,40 € -
1 x C13orf31-c...121,50 € -
1 x GTPBP8-GTP...113,40 € -
1 x NSMCE4A-no...121,50 € -
-
1 x C19orf25-c...113,40 € -
1 x EIF3K-euka...113,40 € -
1 x CAPNS1-cal...121,50 € -
1 x MARK4-MAP/...113,40 € -
1 x HSD17B11-h...121,50 € -
1 x GORASP1-go...121,50 € -
1 x RMND5A-req...121,50 € -
1 x MIPOL1-mir...113,40 € -
1 x GMDS-GDP-m...121,50 €
No products
To be determined Shipping
2 343,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 343,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 343,98 €
Data sheet of FABP1-fatty acid binding protein 1, liver Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP1-fatty acid binding protein 1, liver Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032801 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP1 |
| Origin species: | Human |
| Product name: | FABP1-fatty acid binding protein 1, liver Gene |
| Size: | 2ug |
| Accessions: | BC032801 |
| Gene id: | 2168 |
| Gene description: | fatty acid binding protein 1, liver |
| Synonyms: | FABPL; L-FABP; fatty acid-binding protein, liver; fatty acid binding protein 1, liver; liver-type fatty acid-binding protein; fatty acid binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtttctccggcaagtaccaactgcagagccaggaaaactttgaagccttcatgaaggcaatcggtctgccggaagagctcatccagaaggggaaggatatcaagggggtgtcggaaatcgtgcagaatgggaagcacttcaagttcaccatcaccgctgggtccaaagtgatccaaaacgaattcacggtgggggaggaatgtgagctggagacaatgacaggggagaaagtcaagacagtggttcagttggaaggtgacaataaactggtgacaactttcaaaaacatcaagtctgtgaccgaactcaacggcgacataatcaccaataccatgacattgggtgacattgtcttcaagagaatcagcaagagaatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2L 6 - RAS (RAD and GEM)-like GTP binding 2 - microfibrillar associated protein 5 - organic solute transporter alpha |