Cart 2 Product Products 225,44 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
No products
To be determined Shipping
225,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 225,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 225,44 €
Data sheet of GAGE12I-G antigen 12I Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAGE12I-G antigen 12I Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031628 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAGE12I |
| Origin species: | Human |
| Product name: | GAGE12I-G antigen 12I Gene |
| Size: | 2ug |
| Accessions: | BC031628 |
| Gene id: | 26748 |
| Gene description: | G antigen 12I |
| Synonyms: | AL4; CT4.7; GAGE-7B; GAGE7B; G antigen 12I; G antigen 7B; cancer/testis antigen 4.7; g antigen 12F/G/I |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagttggcgaggaagatcgacctattattggcctagaccaaggcgctatgtacagcctcctgaaatgattgggcctatgcggcccgagcagttcagtgatgaagtggaaccagcaacacctgaagaaggggaaccagcaactcaacgtcaggatcctgcagctgctcaggagggagaggatgagggagcatctgcaggtcaagggccgaagcctgaagctcatagccaggaacagggtcacccacagactgggtgtgagtgtgaagatggtcctgatgggcaggagatggacccgccaaatccagaggaggtgaaaacgcctgaagaaggtgaaaagcaatcacagtgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cystatin 9-like - riboflavin kinase - peroxiredoxin 1 - forkhead box A3 |