Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RPLP1-ribosomal protein, large, P1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPLP1-ribosomal protein, large, P1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPLP1 |
| Origin species: | Human |
| Product name: | RPLP1-ribosomal protein, large, P1 Gene |
| Size: | 2ug |
| Accessions: | BC003369 |
| Gene id: | 6176 |
| Gene description: | ribosomal protein, large, P1 |
| Synonyms: | LP1; RPP1; 60S acidic ribosomal protein P1; acidic ribosomal phosphoprotein P1; ribosomal protein, large, P1; ribosomal protein lateral stalk subunit P1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcctcatctgcaatgtaggggccggtggacctgctccagcagctggtgctgcaccagcaggaggtcctgccccctccactgctgctgctccagctgaggagaagaaagtggaagcaaagaaagaagaatccgaggagtctgatgatgacatgggctttggtctttttgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - claudin domain containing 1 - snail homolog 1 (Drosophila) - integral membrane protein 2B - RNA binding motif protein 11 |