> >>TYROBP-TYRO protein tyrosine kinase binding protein Gene
TYROBP-TYRO protein tyrosine kinase binding protein Gene View larger

TYROBP-TYRO protein tyrosine kinase binding protein Gene

PTXBC011175

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TYROBP-TYRO protein tyrosine kinase binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TYROBP-TYRO protein tyrosine kinase binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011175
Product type: DNA & cDNA
Ncbi symbol: TYROBP
Origin species: Human
Product name: TYROBP-TYRO protein tyrosine kinase binding protein Gene
Size: 2ug
Accessions: BC011175
Gene id: 7305
Gene description: TYRO protein tyrosine kinase binding protein
Synonyms: KARAP; PLOSL; TYRO protein tyrosine kinase-binding protein; DNAX-activation protein 12; KAR-associated protein; killer-activating receptor-associated protein; TYRO protein tyrosine kinase binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggggacttgaaccctgcagcaggctcctgctcctgcctctcctgctggctgtaagtggtctccgtcctgtccaggcccaggcccagagcgattgcagttgctctacggtgagcccgggcgtgctggcagggatcgtgatgggagacctggtgctgacagtgctcattgccctggccgtgtacttcctgggccggctggtccctcgggggcgaggggctgcggaggcagcgacccggaaacagcgtatcactgagaccgagtcgccttatcaggagctccagggtcagaggtcggatgtctacagcgacctcaacacacagaggccgtattacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 26, member E
- dehydrogenase/reductase (SDR family) X-linked
- family with sequence similarity 96, member A
- tRNA selenocysteine 1 associated protein 1

Reviews

Buy TYROBP-TYRO protein tyrosine kinase binding protein Gene now

Add to cart