> >>CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene
CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene View larger

CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene

PTXBC013155

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013155
Product type: DNA & cDNA
Ncbi symbol: CRYZL1
Origin species: Human
Product name: CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene
Size: 2ug
Accessions: BC013155
Gene id: 9946
Gene description: crystallin, zeta (quinone reductase)-like 1
Synonyms: 4P11; QOH-1; quinone oxidoreductase-like protein 1; crystallin, zeta (quinone reductase)-like 1; protein 4P11; quinone oxidoreductase homolog 1; quinone reductase-like 1; zeta-crystallin homolog; crystallin zeta like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaggcttatatttccaacagagttccacagatgaagaaataacatttgtatttcaagaaaaggaagatcttcctgttacagaggataactttgtgaaacttcaagttaaagcttgtgctctgagccagataaatacaaagcttctggcagaaatgaagatgaaaaaggatttatttcctgttgggagagaaattgctggaattgtattagatgttggaagcaaggtatcattctttcaaccagatgatgaagtagttgaagtactttcccggctgggtgctgtggctcacgtctgtaatcccagcacgttgggaggccaaggtgggcgaatcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ARP8 actin-related protein 8 homolog (yeast)
- alkB, alkylation repair homolog 6 (E. coli)
- golgi reassembly stacking protein 1, 65kDa
- coagulation factor VIII, procoagulant component

Reviews

Buy CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene now

Add to cart