Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013069 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCBL1 |
| Origin species: | Human |
| Product name: | CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene |
| Size: | 2ug |
| Accessions: | BC013069 |
| Gene id: | 883 |
| Gene description: | cysteine conjugate-beta lyase, cytoplasmic |
| Synonyms: | CCBL1; GTK; KAT1; KATI; kynurenine--oxoglutarate transaminase 1; beta-lysase, kidney; cysteine conjugate beta lyase 1; cysteine conjugate-beta lyase, cytoplasmic; cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase); cysteine-S-conjugate beta-lyase; glutamine transaminase K; glutamine--phenylpyruvate transaminase; glutamine-phenylpyruvate aminotransferase; kyneurenine aminotransferase; kynurenine aminotransferase I; kynurenine--oxoglutarate transaminase I; kynurenine aminotransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgccaccacacccggccaatttttttatttttggtagagacggggtttagccatgttggccaggctggtcttgaactcctgacctcaggtgatccacccgtctcagcctcccaaagtgctgggattataggcgtgagccaccgcacctggccttgttcctctgactttgatgcagctctaggtgctggattggagctaactctccttccccgcctggtcgtgggaacctctctgtcccctccggagccaaggcctgctgggccacgaggccgtgttgagacatgtccttcctcctccccagggcttggtggccatccctgtctccatcttctatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+/K+ exchanging, beta polypeptide - transcription elongation factor A (SII), 2 - mitogen-activated protein kinase kinase 2 - eukaryotic translation termination factor 1 |