CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene View larger

CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene

PTXBC013069

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013069
Product type: DNA & cDNA
Ncbi symbol: CCBL1
Origin species: Human
Product name: CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene
Size: 2ug
Accessions: BC013069
Gene id: 883
Gene description: cysteine conjugate-beta lyase, cytoplasmic
Synonyms: CCBL1; GTK; KAT1; KATI; kynurenine--oxoglutarate transaminase 1; beta-lysase, kidney; cysteine conjugate beta lyase 1; cysteine conjugate-beta lyase, cytoplasmic; cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase); cysteine-S-conjugate beta-lyase; glutamine transaminase K; glutamine--phenylpyruvate transaminase; glutamine-phenylpyruvate aminotransferase; kyneurenine aminotransferase; kynurenine aminotransferase I; kynurenine--oxoglutarate transaminase I; kynurenine aminotransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgccaccacacccggccaatttttttatttttggtagagacggggtttagccatgttggccaggctggtcttgaactcctgacctcaggtgatccacccgtctcagcctcccaaagtgctgggattataggcgtgagccaccgcacctggccttgttcctctgactttgatgcagctctaggtgctggattggagctaactctccttccccgcctggtcgtgggaacctctctgtcccctccggagccaaggcctgctgggccacgaggccgtgttgagacatgtccttcctcctccccagggcttggtggccatccctgtctccatcttctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+/K+ exchanging, beta polypeptide
- transcription elongation factor A (SII), 2
- mitogen-activated protein kinase kinase 2
- eukaryotic translation termination factor 1

Reviews

Buy CCBL1-cysteine conjugate-beta lyase, cytoplasmic Gene now

Add to cart