BRP44L-brain protein 44-like Gene

View larger

BRP44L-brain protein 44-like Gene

Reference: PTXBC000810

Condition: New product

Print

Data sheet of BRP44L-brain protein 44-like Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about BRP44L-brain protein 44-like Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC000810
Product type:	DNA & cDNA
Ncbi symbol:	BRP44L
Origin species:	Human
Product name:	BRP44L-brain protein 44-like Gene
Size:	2ug
Accessions:	BC000810
Gene id:	51660
Gene description:	brain protein 44-like
Synonyms:	BRP44L; CGI-129; MPYCD; dJ68L15.3; mitochondrial pyruvate carrier 1; HSPC040 protein; brain protein 44-like protein
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcgggcgcgttggtgcggaaagcggcggactatgtccgaagcaaggatttccgggactacctcatgagtacgcacttctggggcccagtagccaactggggtcttcccattgctgccatcaatgatatgaaaaagtctccagagattatcagtgggcggatgacatttgccctctgttgctattctttgacattcatgagatttgcctacaaggtacagcctcggaactggcttctgtttgcatgccacgcaacaaatgaagtagcccagctcatccagggagggcggcttatcaaacacgagatgactaaaacggcatctgcataa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- spermatid maturation 1 - Bardet-Biedl syndrome 9 - catenin, beta like 1 - UL16 binding protein 2

Reviews

Be the first to write your review !

Buy BRP44L-brain protein 44-like Gene now