Cart 2 Product Products 717,36 € (empty)
-
1 x ABCA9-ATP-...113,40 € -
No products
To be determined Shipping
717,36 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 717,36 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 717,36 €
Data sheet of SERINC2-serine incorporator 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERINC2-serine incorporator 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017085 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERINC2 |
| Origin species: | Human |
| Product name: | SERINC2-serine incorporator 2 Gene |
| Size: | 2ug |
| Accessions: | BC017085 |
| Gene id: | 347735 |
| Gene description: | serine incorporator 2 |
| Synonyms: | FKSG84; PRO0899; TDE2L; serine incorporator 2; tumor differentially expressed protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaccgaggagtgcccacctatgctagacgccacacagcagcagcagcagcaggtggcagcctgtgagggccgggcctttgacaacgagcaggacggcgtcacctacagctactccttcttccacttctgcctggtgctggcctcactgcacgtcatgatgacgctcaccaactggtacaagcccggtgagacccggaagatgatcagcacgtggaccgccgtgtgggtgaagatctgtgccagctgggcagggctgctcctctacctgtggaccctggtagccccactcctcctgcgcaaccgcgacttcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L35a - orthodenticle homeobox 2 - ribosomal protein S15a - DTW domain containing 1 |