PTXBC020495
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC020495 |
Product type: | DNA & cDNA |
Ncbi symbol: | RABL2B |
Origin species: | Human |
Product name: | RABL2B-RAB, member of RAS oncogene family-like 2B Gene |
Size: | 2ug |
Accessions: | BC020495 |
Gene id: | 11158 |
Gene description: | RAB, member of RAS oncogene family-like 2B |
Synonyms: | rab-like protein 2B; RAB, member of RAS oncogene family-like 2B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcagaagacaaaaccaaaccgagtgagttggaccaagggaagtatgatgctgatgacaacgtgaagatcatctgcctgggagacagcgcagtgggcaaatccaaactcatggagagatttctcatggatggctttcagccacagcagctgtccacgtacgccctgaccctgtacaagcacacagccacggtagatggaaggaccatccttgtggacttttgggacacggcaggccaggagcggttccagagcatgcatgcctcctactaccacaaggcccacgcctgcatcatgtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - acyl-Coenzyme A binding domain containing 4 - putative homeodomain transcription factor 2 - twisted gastrulation homolog 1 (Drosophila) - fibroblast growth factor binding protein 2 |