Cart 32 Product Products 17 874,97 € (empty)
-
-
1 x MRPL14-mit...113,40 € -
1 x PFDN5-pref...113,40 € -
1 x HSD11B1L-h...113,40 € -
1 x BCAS1-brea...121,50 € -
1 x PARP6-poly...113,40 € -
-
-
1 x C17orf62-c...113,40 € -
1 x C3AR1-comp...121,50 € -
1 x RTN4-retic...121,50 € -
-
-
-
1 x CEP170L-ce...121,50 € -
1 x KLHL20-kel...113,40 € -
1 x PPAN-peter...121,50 € -
1 x SRPX2-sush...121,50 € -
1 x E2F3-E2F...113,40 € -
1 x HLA-A-majo...121,50 € -
1 x MMD-monocy...113,40 € -
1 x C10orf116-...113,40 € -
1 x CPLX2-comp...113,40 € -
1 x FAM134B-fa...113,40 € -
1 x ITPK1-inos...121,50 € -
1 x TPTE2-tran...121,50 € -
1 x FAM182A-fa...113,40 € -
1 x StARD13...259,07 € -
1 x CD69-CD69...113,40 € -
1 x SH2D1B-SH2...113,40 € -
1 x C3orf23-ch...121,50 € -
No products
To be determined Shipping
17 874,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 17 874,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 17 874,97 €
View larger 
Data sheet of UQCRH-ubiquinol-cytochrome c reductase hinge protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCRH-ubiquinol-cytochrome c reductase hinge protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001426 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCRH |
| Origin species: | Human |
| Product name: | UQCRH-ubiquinol-cytochrome c reductase hinge protein Gene |
| Size: | 2ug |
| Accessions: | BC001426 |
| Gene id: | 7388 |
| Gene description: | ubiquinol-cytochrome c reductase hinge protein |
| Synonyms: | QCR6; UQCR8; cytochrome b-c1 complex subunit 6, mitochondrial; complex III subunit 6; cytochrome c1 non-heme 11 kDa protein; mitochondrial hinge protein; ubiquinol-cytochrome c reductase complex 11 kDa protein; ubiquinol-cytochrome c reductase, complex III subunit VIII; ubiquinol-cytochrome c reductase hinge protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggactggaggacgagcaaaagatgcttaccgaatccggagatcctgaggaggaggaagaggaagaggaggaattagtggatcccctaacaacagtgagagagcaatgcgagcagttggagaaatgtgtaaaggcccgggagcggctagagctctgtgatgagcgtgtatcctctcgatcacatacagaagaggattgcacggaggagctctttgacttcttgcatgcgagggaccattgcgtggcccacaaactctttaacaacttgaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B-cell translocation gene 1, anti-proliferative - nicotinamide nucleotide adenylyltransferase 3 - cell division cycle 34 homolog (S. cerevisiae) - complement component 1, q subcomponent, C chain |