Cart 2 Product Products 226,80 € (empty)
-
1 x LZIC-leuci...113,40 € -
1 x SPINK4-ser...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
View larger 
MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene
PTXBC010464
New product
Data sheet of MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010464 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAP3K3 |
| Origin species: | Human |
| Product name: | MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene |
| Size: | 2ug |
| Accessions: | BC010464 |
| Gene id: | 4215 |
| Gene description: | mitogen-activated protein kinase kinase kinase 3 |
| Synonyms: | MAPKKK3; mitogen-activated protein kinase kinase kinase 3; MAP/ERK kinase kinase 3; MAPK/ERK kinase kinase 3; MEK kinase 3; MEKK 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgaagcaaatgtcatgctgccttattcagggaaggaggagcctgtcctgcctgtggccatgaccctgcctctcccaggcaggggcccgcgatgtggaactgctgccactgaggggggatccagttttgtcaatgcagttgtctctgttttacaagttggagtcactcttatgctgtacccagtttctaaactggagactgtgtgtgccctctgggctctgagtacccctgctttgggcttgggcctaggctgcattgaaaagagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C1q and tumor necrosis factor related protein 4 - ubiquinol-cytochrome c reductase complex chaperone - family with sequence similarity 108, member A1 - non-SMC element 2, MMS21 homolog (S. cerevisiae) |