MGC5566-hypothetical protein MGC5566 Gene View larger

MGC5566-hypothetical protein MGC5566 Gene

PTXBC000849

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC5566-hypothetical protein MGC5566 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC5566-hypothetical protein MGC5566 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000849
Product type: DNA & cDNA
Ncbi symbol: MGC5566
Origin species: Human
Product name: MGC5566-hypothetical protein MGC5566 Gene
Size: 2ug
Accessions: BC000849
Gene id: 79015
Gene description: hypothetical protein MGC5566
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtctaatgactgcgccccacacacaccagagaggactgcagatagtgcgggatgagaggaagatctctggccctggagacagcatcatcaagcgaaaacgtatgaggaagaaaatagcagatgagaagaatcaaccaaattccggaagctggaaggcagatgcaagaaggcccttgaatgatgccagcaccttgatattggactttccagcctccagaaccatgagccaatacatttctgttccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC5590
- S100 calcium binding protein P
- acylphosphatase 2, muscle type
- dual specificity phosphatase 3

Reviews

Buy MGC5566-hypothetical protein MGC5566 Gene now

Add to cart