Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
Data sheet of RPS21-ribosomal protein S21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPS21-ribosomal protein S21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018140 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPS21 |
| Origin species: | Human |
| Product name: | RPS21-ribosomal protein S21 Gene |
| Size: | 2ug |
| Accessions: | BC018140 |
| Gene id: | 6227 |
| Gene description: | ribosomal protein S21 |
| Synonyms: | HLDF; S21; 40S ribosomal protein S21; 8.2 kDa differentiation factor; human leukemia differentiation factor; ribosomal protein S21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaacgacgccggcgagttcgtggacctgtacgtgccgcggaaatgctccgctagcaatcgcatcatcggtgccaaggaccacgcatccatccagatgaacgtggccgaggttgacaaggtcacaggcaggtttaatggccagtttaaaacttatgctatctgcggggccattcgtaggatgggtgagtcagatgattccattctccgattggccaaggccgatggcatcgtctcaaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MYC associated factor X - lysophospholipase II - LIM and SH3 protein 1 - Rap GTPase interactor |