Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TSC22D3-TSC22 domain family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSC22D3-TSC22 domain family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018148 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSC22D3 |
| Origin species: | Human |
| Product name: | TSC22D3-TSC22 domain family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC018148 |
| Gene id: | 1831 |
| Gene description: | TSC22 domain family, member 3 |
| Synonyms: | DIP; DSIPI; TSC-22R; TSC22 domain family protein 3; DSIP-immunoreactive leucine zipper protein; DSIP-immunoreactive peptide; TSC-22 related protein; TSC-22-like protein; delta sleep-inducing peptide immunoreactor; glucocorticoid-induced leucine zipper protein; TSC22 domain family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatctggtgaagaatcatctgatgtatgctgtgagagaggaggtggagatcctgaaggagcagatccgagagctggtggagaagaactcccagctagagcgtgagaacaccctgttgaagaccctggcaagcccagagcagctggagaagttccagtcctgtctgagccctgaagagccagctcccgaatccccacaagtgcccgaggcccctggtggttctgcggtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 17 - intestinal cell (MAK-like) kinase - tripartite motif-containing 31 - G protein-coupled receptor 171 |