Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DPM2-dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit Gene
PTXBC015374
New product
Data sheet of DPM2-dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DPM2-dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015374 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DPM2 |
| Origin species: | Human |
| Product name: | DPM2-dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit Gene |
| Size: | 2ug |
| Accessions: | BC015374 |
| Gene id: | 8818 |
| Gene description: | dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit |
| Synonyms: | CDG1U; dolichol phosphate-mannose biosynthesis regulatory protein; DPM synthase complex subunit; DPM synthase subunit 2; dolichol-phosphate mannose synthase subunit 2; dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit; dolichyl-phosphate mannosyltransferase subunit 2, regulatory |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacggggacagaccaggtggtgggactcggcctcgtcgccgttagcctgatcatcttcacctactacaccgcctgggtgattctcttggtatgtcattctccccgtccgctgctcaccttccccgagccctggcaccgccagagcaactactatataggctctaggcacggcgctggcttcattgcctgcctcatctcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) - guanine nucleotide binding protein (G protein), beta polypeptide 1-like - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 - neural precursor cell expressed, developmentally down-regulated 4-like |