Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FNDC3B-fibronectin type III domain containing 3B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FNDC3B-fibronectin type III domain containing 3B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012204 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FNDC3B |
| Origin species: | Human |
| Product name: | FNDC3B-fibronectin type III domain containing 3B Gene |
| Size: | 2ug |
| Accessions: | BC012204 |
| Gene id: | 64778 |
| Gene description: | fibronectin type III domain containing 3B |
| Synonyms: | FAD104; PRO4979; YVTM2421; fibronectin type III domain-containing protein 3B; HCV NS5A-binding protein 37; factor for adipocyte differentiation 104; fibronectin type III domain containing 3B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgatgaccgaccaaatccctctggaactgccaccattgctgaacggagaggtagccatgatgccccacttggtgaatggagatgcagctcagcaggttattctcgttcaagttaatccaggtgagactttcacaataagagcagaggatggaacacttcagtgcattcaagatgaagtggtgaagagagcctgcgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine conjugate-beta lyase, cytoplasmic - ATPase, H+/K+ exchanging, beta polypeptide - transcription elongation factor A (SII), 2 - mitogen-activated protein kinase kinase 2 |