ZNF616-zinc finger protein 616 Gene

View larger

ZNF616-zinc finger protein 616 Gene

Reference: PTXBC032805

Condition: New product

Print

Data sheet of ZNF616-zinc finger protein 616 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about ZNF616-zinc finger protein 616 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC032805
Product type:	DNA & cDNA
Ncbi symbol:	ZNF616
Origin species:	Human
Product name:	ZNF616-zinc finger protein 616 Gene
Size:	2ug
Accessions:	BC032805
Gene id:	90317
Gene description:	zinc finger protein 616
Synonyms:	zinc finger protein 616
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgggatactatgcagccatagaaaggaatgagatcatgtccattgcagcgatgtggatggagctggaagccattatcctcaggaaactaacacaggaacagaaaatcaaacagcacatgttctcacttaaaagtggaagctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- zinc finger protein 706 - keratin 222 pseudogene - adenosine A2b receptor - troponin C type 1 (slow)

Reviews

Be the first to write your review !

Buy ZNF616-zinc finger protein 616 Gene now