LOC57228-small trans-membrane and glycosylated protein Gene View larger

LOC57228-small trans-membrane and glycosylated protein Gene

PTXBC003379

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC57228-small trans-membrane and glycosylated protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC57228-small trans-membrane and glycosylated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003379
Product type: DNA & cDNA
Ncbi symbol: LOC57228
Origin species: Human
Product name: LOC57228-small trans-membrane and glycosylated protein Gene
Size: 2ug
Accessions: BC003379
Gene id: 57228
Gene description: small trans-membrane and glycosylated protein
Synonyms: hSMAGP; small cell adhesion glycoprotein; small cell transmembrane and glycosylated protein; small trans-membrane and glycosylated protein; small transmembrane and glycosylated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacctacagaaggtgagcccagtgccatcgtccagatggagagtgacttggccaagggcagcgagaaagaggaatatttcatctaatgactcccaggccccaaggagcttattcctggctccatcgctaacacgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high mobility group nucleosomal binding domain 3
- UDP-glucose ceramide glucosyltransferase-like 2
- FXYD domain containing ion transport regulator 1
- Sfi1 homolog, spindle assembly associated (yeast)

Reviews

Buy LOC57228-small trans-membrane and glycosylated protein Gene now

Add to cart