Cart 14 Product Products 2 656,24 € (empty)
-
1 x OLA1-Obg-l...121,50 € -
1 x IFI27-inte...113,40 € -
1 x C10orf111-...113,40 € -
1 x OGN-osteog...121,50 € -
1 x GDAP1L1-ga...121,50 € -
1 x NKIRAS2-NF...113,40 € -
-
1 x HBB-hemogl...113,40 € -
1 x HSPC152-hy...113,40 € -
1 x STT3B-STT3...113,40 € -
1 x GDE1-glyce...113,40 € -
-
1 x Visfatin...694,00 € -
No products
To be determined Shipping
2 656,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 656,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 656,24 €
View larger 
AGPAT1-1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) Gene
PTXBC006818
New product
Data sheet of AGPAT1-1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGPAT1-1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006818 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGPAT1 |
| Origin species: | Human |
| Product name: | AGPAT1-1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) Gene |
| Size: | 2ug |
| Accessions: | BC006818 |
| Gene id: | 10554 |
| Gene description: | 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccccacccagccccctgcagccctgctgcaccatctcaccagacacaaggggaagaagcagacatcaggtgctgcactcacttctgccccctggggagttggggaaaggaacgaaccctggctggaggggatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 - myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 - 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 |