Cart 40 Product Products 5 528,03 € (empty)
-
1 x Cortisol...339,00 € -
-
1 x KLK10-kall...121,50 € -
-
-
-
1 x HMGN1-high...113,40 € -
1 x ZIM3-zinc...121,50 € -
-
1 x MYL6B-myos...113,40 € -
-
-
-
-
1 x STK32B-ser...121,50 € -
-
-
1 x CAMK1G-cal...121,50 € -
1 x CAPSL-calc...113,40 € -
1 x HIST1H4H-h...113,40 € -
1 x Mas1...259,07 € -
-
1 x TINAGL1-tu...121,50 € -
1 x TSHR-thyro...113,40 € -
-
-
1 x TMEM103-tr...121,50 € -
1 x OR2L13-olf...121,50 € -
-
1 x C6orf218-c...113,40 € -
1 x Olfactory...259,07 € -
-
-
1 x TSPAN15-te...121,50 € -
1 x EID1-EP300...113,40 € -
1 x PRR10-prol...113,40 € -
1 x SCRN3-sece...121,50 € -
-
1 x ZACN-zinc...121,50 € -
No products
To be determined Shipping
5 528,03 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 40 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 528,03 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 528,03 €
Data sheet of THPO-thrombopoietin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about THPO-thrombopoietin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130322 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | THPO |
| Origin species: | Human |
| Product name: | THPO-thrombopoietin Gene |
| Size: | 2ug |
| Accessions: | BC130322 |
| Gene id: | 7066 |
| Gene description: | thrombopoietin |
| Synonyms: | MGDF; MKCSF; MPLLG; THCYT1; TPO; MPL ligand; c-mpl ligand; megakaryocyte colony-stimulating factor; megakaryocyte growth and development factor; megakaryocyte stimulating factor; myeloproliferative leukemia virus oncogene ligand; prepro-thrombopoietin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgactgaattgctcctcgtggtcatgcttctcctaactgcaaggctaacgctgtccagcccggctcctcctgcttgtgacctccgagtcctcagtaaactgcttcgtgactcccatgtccttcacagcagactgagccagtgcccagaggttcaccctttgcctacacctgtcctgctgcctgctgtggactttagcttgggagaatggaaaacccagatggaggagaccaaggcacaggacattctgggagcagtgacccttctgctggagggagtgatggcagcacggggacaactgggacccacttgcctctcatccctcctggggcagctttctggacaggtccgtctcctccttggggccctgcagagcctccttggaacccagggcaggaccacagctcacaaggatcccaatgccatcttcctgagcttccaacacctgctccgaggaaaggtgcgtttcctgatgcttgtaggagggtccaccctctgcgtcaggcgggccccacccaccacagctgtccccagcagaacctctctagtcctcacactgaacgagctcccaaacaggacttctggattgttggagacaaacttcactgcctcagccagaactactggctctgggcttctgaagtggcagcagggattcagagccaagattcctggtctgctgaaccaaacctccaggtccctggaccaaatccccggatacctgaacaggatacacgaactcttgaatggaactcgtggactctttcctggaccctcacgcaggaccctaggagccccggacatttcctcaggaacatcagacacaggctccctgccacccaacctccagcctggatattctccttccccaacccatcctcctactggacagtatacgctcttccctcttccacccaccttgcccacccctgtggtccagctccaccccctgcttcctgacccttctgctccaacgcccacccctaccagccctcttctaaacacatcctacacccactcccagaatctgtctcaggaagggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAO kinase 3 - CD52 molecule - neuropeptide Y - COBL-like 1 |