Cart 21 Product Products 3 241,32 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
1 x LSM2-LSM2...113,40 € -
1 x THEX1-thre...121,50 € -
-
1 x C14orf94-c...121,50 € -
1 x SIAH1-seve...121,50 € -
1 x PHC2-polyh...121,50 € -
1 x NUF2-NUF2,...121,50 € -
1 x GLYATL2-gl...121,50 € -
1 x SLC25A31-s...121,50 € -
1 x LigaTrap...576,82 € -
1 x AQP1-aquap...121,50 € -
1 x TSPAN6-tet...113,40 € -
1 x UTP11L-UTP...113,40 € -
1 x CORO6-coro...113,40 € -
1 x RAD9A-RAD9...121,50 € -
1 x BRSK1-BR...121,50 € -
1 x TFB1M-tran...121,50 €
No products
To be determined Shipping
3 241,32 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 241,32 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 241,32 €
View larger 
B4GALT5-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 Gene
PTXBC112265
New product
Data sheet of B4GALT5-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B4GALT5-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112265 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B4GALT5 |
| Origin species: | Human |
| Product name: | B4GALT5-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 Gene |
| Size: | 2ug |
| Accessions: | BC112265 |
| Gene id: | 9334 |
| Gene description: | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 |
| Synonyms: | B4Gal-T5; BETA4-GALT-IV; beta4Gal-T5; beta4GalT-V; gt-V; beta-1,4-galactosyltransferase 5; UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 5; UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5; UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 5; beta-1,4-GalT II; beta-1,4-GalT IV; beta-1,4-GalTase 5; beta-1.4-galactosyltransferase V; beta4-GalT IV |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgcgcccgccgggggctgctgcggctgccgcgccgctcgctgctcgccgcgctcttcttcttttctctctcgtcctcgctgctgtacttcgtctatgtggcgcccggcatagtgaacacctacctcttcatgatgcaagcccaaggcattctgatccgggacaacgtgagaacaatcggtgctcaggtttatgagcaggtgcttcggagtgcttatgccaagaggaacagcagtgtaaatgactcagattatcctcttgacttgaaccacagtgaaaccttcctgcaaactacaacatttcttcctgaagacttcacctactttgcaaaccatacctgccctgaaagactcccttccatgaagggcccaatagacataaacatgagtgaaattggaatggattacattcatgaactcttctccaaagacccaaccatcaagctcggaggtcactggaagccttctgattgcatgcctcggtggaaggtggcgatccttatccccttccggaaccgccacgagcacctcccagtcctgttcagacacctgcttcccatgctccagcgccagcgcttgcagtttgcattttatgtggttgaacaagttggtacccaaccctttaatcgagccatgcttttcaacgttggctttcaagaggcaatgaaagacttggattgggactgtttgatttttcatgatgtagatcacataccggaaagtgatcgcaactattatggatgtggacagatgccgaggcattttgcaaccaaattggataagtatatgtatctgcttccttataccgagttctttggcggagtgagtggcttaacagtggaacaatttcggaaaatcaatggctttcctaatgctttctggggttggggtggagaagatgacgacctctggaacagagtacagaatgcaggctattctgtgagccggccagagggtgacacaggaaagtacaagtccattcctcatcaccatcgaggagaagtccagtttcttggaaggtatgctctgctgaggaagtcaaaagaacggcaagggctggatggcctcaacaacctgaactactttgcaaacatcacatacgacgccttgtataaaaacataactgtcaacctgacacccgagctggctcaggtgaacgagtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquinol-cytochrome c reductase hinge protein - B-cell translocation gene 1, anti-proliferative - nicotinamide nucleotide adenylyltransferase 3 - cell division cycle 34 homolog (S. cerevisiae) |