Cart 3 Product Products 339,81 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
No products
To be determined Shipping
339,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 339,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 339,81 €
Data sheet of LPAR3-lysophosphatidic acid receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LPAR3-lysophosphatidic acid receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LPAR3 |
| Origin species: | Human |
| Product name: | LPAR3-lysophosphatidic acid receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC126268 |
| Gene id: | 23566 |
| Gene description: | lysophosphatidic acid receptor 3 |
| Synonyms: | EDG7; Edg-7; GPCR; HOFNH30; LP-A3; LPA3; RP4-678I3; lysophosphatidic acid receptor 3; LPA receptor 3; LPA receptor EDG7; LPA-3; calcium-mobilizing lysophosphatidic acid receptor LP-A3; endothelial cell differentiation gene 7; endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7; lysophosphatidic acid receptor Edg-7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgagtgtcactatgacaagcacatggactttttttataataggagcaacactgatactgtcgatgactggacaggaacaaagcttgtgattgttttgtgtgttgggacgtttttctgcctgtttatttttttttctaattctctggtcatcgcggcagtgatcaaaaacagaaaatttcatttccccttctactacctgttggctaatttagctgctgccgatttcttcgctggaattgcctatgtattcctgatgtttaacacaggcccagtttcaaaaactttgactgtcaaccgctggtttctccgtcaggggcttctggacagtagcttgactgcttccctcaccaacttgctggttatcgccgtggagaggcacatgtcaatcatgaggatgcgggtccatagcaacctgaccaaaaagagggtgacactgctcattttgcttgtctgggccatcgccatttttatgggggcggtccccacactgggctggaattgcctctgcaacatctctgcctgctcttccctggcccccatttacagcaggagttaccttgttttctggacagtgtccaacctcatggccttcctcatcatggttgtggtgtacctgcggatctacgtgtacgtcaagaggaaaaccaacgtcttgtctccgcatacaagtgggtccatcagccgccggaggacacccatgaagctaatgaagacggtgatgactgtcttaggggcgtttgtggtatgctggaccccgggcctggtggttctgctcctcgacggcctgaactgcaggcagtgtggcgtgcagcatgtgaaaaggtggttcctgctgctggcgctgctcaactccgtcgtgaaccccatcatctactcctacaaggacgaggacatgtatggcaccatgaagaagatgatctgctgcttctctcaggagaacccagagaggcgtccctctcgcatcccctccacagtcctcagcaggagtgacacaggcagccagtacatagaggatagtattagccaaggtgcagtctgcaataaaagcacttcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - syntaxin 11 - homeobox A1 - endothelin 3 - claudin 12 |