Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of POU5F1-POU class 5 homeobox 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POU5F1-POU class 5 homeobox 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117437 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POU5F1 |
| Origin species: | Human |
| Product name: | POU5F1-POU class 5 homeobox 1 Gene |
| Size: | 2ug |
| Accessions: | BC117437 |
| Gene id: | 5460 |
| Gene description: | POU class 5 homeobox 1 |
| Synonyms: | OCT3; OTF-3; OTF3; OTF4; Oct-3; Oct-4; POU domain, class 5, transcription factor 1; POU class 5 homeobox 1 transcript variant OCT4B1; POU class 5 homeobox 1 transcript variant OCT4B2; POU class 5 homeobox 1 transcript variant OCT4B3; POU class 5 homeobox 1 transcript variant OCT4B4; POU class 5 homeobox 1 transcript variant OCT4B5; POU class 5 homeobox 1 transcript variant OCT4B6; POU classV homeobox 1 variant 2; POU domain transcription factor OCT4; POU-type homeodomain-containing DNA-binding protein; octamer-binding protein 3; octamer-binding protein 4; octamer-binding transcription factor 3; POU class 5 homeobox 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggacacctggcttcagattttgccttctcgccccctccaggtggtggaggtgatgggccaggggggccggagccgggctgggttgatcctcggacctggctaagcttccaaggccctcctggagggccaggaatcgggccgggggttgggccaggctctgaggtgtgggggattcccccatgccccccgccgtatgagttctgtggggggatggcgtactgtgggccccaggttggagtggggctagtgccccaaggcggcttggagacctctcagcctgagggcgaagcaggagtcggggtggagagcaactccgatggggcctccccggagccctgcaccgtcacccctggtgccgtgaagctggagaaggagaagctggagcaaaacccggaggagtcccaggacatcaaagctctgcagaaagaactcgagcaatttgccaagctcctgaagcagaagaggatcaccctgggatatacacaggccgatgtggggctcaccctgggggttctatttgggaaggtattcagccaaacgaccatctgccgctttgaggctctgcagcttagcttcaagaacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatcaagcagcgactatgcacaacgagaggattttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgagggggaagcctttccccctgtctctgtcaccactctgggctctcccatgcattcaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - POU class 4 homeobox 3 - tyrosine aminotransferase - protocadherin alpha 6 - SH2B adaptor protein 3 |