POU5F1-POU class 5 homeobox 1 Gene View larger

POU5F1-POU class 5 homeobox 1 Gene

PTXBC117435

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POU5F1-POU class 5 homeobox 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POU5F1-POU class 5 homeobox 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC117435
Product type: DNA & cDNA
Ncbi symbol: POU5F1
Origin species: Human
Product name: POU5F1-POU class 5 homeobox 1 Gene
Size: 2ug
Accessions: BC117435
Gene id: 5460
Gene description: POU class 5 homeobox 1
Synonyms: OCT3; OTF-3; OTF3; OTF4; Oct-3; Oct-4; POU domain, class 5, transcription factor 1; POU class 5 homeobox 1 transcript variant OCT4B1; POU class 5 homeobox 1 transcript variant OCT4B2; POU class 5 homeobox 1 transcript variant OCT4B3; POU class 5 homeobox 1 transcript variant OCT4B4; POU class 5 homeobox 1 transcript variant OCT4B5; POU class 5 homeobox 1 transcript variant OCT4B6; POU classV homeobox 1 variant 2; POU domain transcription factor OCT4; POU-type homeodomain-containing DNA-binding protein; octamer-binding protein 3; octamer-binding protein 4; octamer-binding transcription factor 3; POU class 5 homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggacacctggcttcggatttcgccttctcgccccctccaggtggtggaggtgatgggccaggggggccggagccgggctgggttgatcctcggacctggctaagcttccaaggccctcctggagggccaggaatcgggccgggggttgggccaggctctgaggtgtgggggattcccccatgccccccgccgtatgagttctgtggggggatggcgtactgtgggccccaggttggagtggggctagtgccccaaggcggcttggagacctctcagcctgagggcgaagcaggagtcggggtggagagcaactccgatggggcctccccggagccctgcaccgtcacccctggtgccgtgaagctggagaaggagaagctggagcaaaacccggaggagtcccaggacatcaaagctctgcagaaagaactcgagcaatttgccaagctcctgaagcagaagaggatcaccctgggatatacacaggccgatgtggggctcaccctgggggttctatttgggaaggtattcagccaaacgaccatctgccgctttgaggctctgcagcttagcttcaagaacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatcaagcagcgactatgcacaacgagaggattttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgagggggaagcctttccccctgtctccgtcaccactctgggctctcccatgcattcaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - POU class 5 homeobox 1
- POU class 4 homeobox 3
- tyrosine aminotransferase
- protocadherin alpha 6

Reviews

Buy POU5F1-POU class 5 homeobox 1 Gene now

Add to cart