C8G-complement component 8, gamma polypeptide Gene View larger

C8G-complement component 8, gamma polypeptide Gene

PTXBC113626

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8G-complement component 8, gamma polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8G-complement component 8, gamma polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC113626
Product type: DNA & cDNA
Ncbi symbol: C8G
Origin species: Human
Product name: C8G-complement component 8, gamma polypeptide Gene
Size: 2ug
Accessions: BC113626
Gene id: 733
Gene description: complement component 8, gamma polypeptide
Synonyms: C8C; complement component C8 gamma chain; complement component 8, gamma polypeptide; complement C8 gamma chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgccccctgggactgcgaccctcttgactctgctcctggcagctggctcgctgggccagaagcctcagaggccacgccggcccgcatcccccatcagcaccatccagcccaaggccaattttgatgctcagcagtttgcagggacctggctccttgtggctgtgggctccgcttgccgtttcctgcaggagcagggccaccgggccgaggccaccacactgcatgtggctccccagggcacagccatggctgtcagtaccttccgaaagctggatgggatctgctggcaggtgcgccagctctatggagacacaggggtcctcggccgcttcctgcttcaagcccgaggcgcccgaggggctgtgaacgtggttgtcgctgagactgactaccagagtttcgctgtcctgtacctggagcgggcggggcagctgtcagtgaagctctacgcccgctcgctccctgtgagcgactcggtcctgagtgggtttgagcagcgggtccaggaggcccacctgactgaggaccagatcttctacttccccaagtacggcttctgcgaggctgcagaccagttccacgtcctggacgaagtgaggaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rabphilin 3A-like (without C2 domains)
- t-complex-associated-testis-expressed 3
- lens intrinsic membrane protein 2, 19kDa
- gonadotropin-releasing hormone receptor

Reviews

Buy C8G-complement component 8, gamma polypeptide Gene now

Add to cart