Cart 23 Product Products 4 799,38 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 € -
1 x ROPN1B-rop...113,40 €
No products
To be determined Shipping
4 799,38 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 799,38 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 799,38 €
View larger 
Data sheet of RSPH1-radial spoke head 1 homolog (Chlamydomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RSPH1-radial spoke head 1 homolog (Chlamydomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113367 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RSPH1 |
| Origin species: | Human |
| Product name: | RSPH1-radial spoke head 1 homolog (Chlamydomonas) Gene |
| Size: | 2ug |
| Accessions: | BC113367 |
| Gene id: | 89765 |
| Gene description: | radial spoke head 1 homolog (Chlamydomonas) |
| Synonyms: | CT79; RSP44; RSPH10A; TSA2; TSGA2; radial spoke head 1 homolog; cancer/testis antigen 79; male meiotic metaphase chromosome-associated acidic protein; testes specific gene A2 homolog; testis specific A2 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggacctgggctcggaggagttggaggaggagggagagaatgatattggggaatatgaggggggtcggaatgaggcaggcgaaaggcacggacgtgggagggcacggctacccaacggggacacctacgaagggagctacgaattcggtaaaagacatggccaggggatctacaaatttaaaaatggtgctcgatatatcggagaatatgttagaaataaaaagcacggtcaaggcacttttatatatccagatggatccagatatgaaggagagtgggcaaatgacctgcggcacggccatggcgtatactactacatcaataatgacacctacactggagagtggtttgctcatcaaaggcatgggcaaggcacctatttatacgcagagacgggcagtaagtatgttggcacctgggtgaacggacagcaggagggcacggccgagctcattcacctgaaccacaggtaccagggcaagttcttgaacaaaaatcctgttggccctggaaagtatgtatttgatgttgggtgtgaacaacatggtgaatatcgtttaacagatatggaaagaggagaagaggaagaggaggaagaattagtaactgttgttccaaaatggaaagctacccaaatcactgaattggccctgtggacaccaactctccccaaaaagccgacctctacggatggacctggccaagacgctccaggagctgagagtgcaggagaacccggggaggaggcccaggctctgctggagggcttcgagggtgagatggacatgaggcctggagatgaagatgcagacgtcctccgggaagagagccgggagtatgaccaggaggagttccgctatgacatggatgagggaaacattaattctgaagaagaagaaactagacagtcagacctccaggactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB, member of RAS oncogene family-like 2A - GIPC PDZ domain containing family, member 3 - family with sequence similarity 9, member A - 5-hydroxytryptamine (serotonin) receptor 5A |